cdna of a woodchuck hepatitis virus post-transcriptional regulatory element (wpre) (Addgene inc)
Addgene inc is a verified supplier 
90
Structured Review
Addgene inc
cdna of a woodchuck hepatitis virus post-transcriptional regulatory element (wpre)
Cdna Of A Woodchuck Hepatitis Virus Post Transcriptional Regulatory Element (Wpre), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+elements/cdna+of+a+woodchuck+hepatitis+virus+post+transcriptional+regulatory+element++wpre+/pmc10555477-62-2-20
Average 90 stars, based on 1 article reviews
Cdna Of A Woodchuck Hepatitis Virus Post Transcriptional Regulatory Element (Wpre), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+elements/cdna+of+a+woodchuck+hepatitis+virus+post+transcriptional+regulatory+element++wpre+/pmc10555477-62-2-20
Average 90 stars, based on 1 article reviews
cdna of a woodchuck hepatitis virus post-transcriptional regulatory element (wpre) - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
cDNA Synthesis:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Quantitative RT-PCR:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Reverse Transcription Polymerase Chain Reaction:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Polymerase Chain Reaction:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. SYBR Green Assay:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Real-time Polymerase Chain Reaction:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Methylation:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Purification:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Staining:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Silver Staining:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Protein-Protein interactions:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. RNA Sequencing:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Recombinant:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# CRISPR:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: .. Materials availability The transporter-focused CRISPR-Cas9 KO library (#221409), an Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Plasmid Preparation:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Software:Article Title: C2H2-zinc-finger transcription factors bind RNA and function in diverse post-transcriptional regulatory processes. Article Snippet: In brief Nabeel-Shah et al. report that transcription factors of the C2H2-ZNF family also function as RNA-binding proteins that participate in multiple posttranscriptional processes, including alternative splicing, alternative polyadenylation, and mA regulation.. Integration of C2H2-ZNF iCLIP-seq data with other omics data reveals multiple modes of RNA binding by C2H2-ZNFs and uncovers mechanistic details. Sequencing:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Knock-Out:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Multiple Displacement Amplification:Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Library Amplification:Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Clone Assay:Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Multiplex Assay:Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# cDNA Library Assay:Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: The IMI2 Joint Undertaking receives support from the European Union’s Horizon 2020 research and innovation program; European Federation of Pharmaceutical Industries and Associations (EFPIA) companies; and associated partners KTH, OICR, Diamond, and McGill. .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Human: HAP1 Horizon Discovery Cat# C631; RRID: CVCL_Y019 Human: HuH-7 JCRB Cat# JCRB0403; RRID: CVCL_0336 Human: 1321N1 ECACC through SIGMA Cat# 86030402-1VL; RRID: CVCL_0110 Human: SK-MEL-28 LGCgenomics through ATCC Cat# HTB-72; RRID: CVCL_0526 Human: HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human: LS180 ECACC through SIGMA Cat# 87021202-1VL; RRID: CVCL_0397 Human: MDA-MB-468 ATCC Cat# HTB-132; RRID: CVCL_0419 Oligonucleotides Library amplification primer This paper N/A sgRNA sequences for individual KO clones This paper N/A sgRNA sequences for KO library This paper N/A NEBNext Multiplex Oligos for Illumina New England Biolabs Cat# Article Title: The efflux pump ABCC1/MRP1 constitutively restricts PROTAC sensitivity in cancer cells. Article Snippet: .. Materials availability The transporter-focused CRISPR-Cas9 KO library (#221409), an |